<meta http-equiv="refresh" content="1; url=/nojavascript/"> Aliens Attack! Mini-Lessons | CK-12 Foundation
Dismiss
Skip Navigation
You are reading an older version of this FlexBook® textbook: CK-12 Modeling and Simulation for High School Teachers: Principles, Problems, and Lesson Plans Go to the latest version.

The Aliens Attack Lesson Unit is comprised of the following Mini-Lessons:

  1. Lesson One: The Engineering Design Process – 8 Simple Steps (1 day)
  2. Lesson Two: Junkyard Cars Launcher (2 days)
  3. Lesson Three: Principles of Evolution by Natural Selection (2 days)
  4. Lesson Four: A Natural Selection Simulation – Options I or II (2 days)
  5. Lesson Five: Mutations and Natural Selection (1½ day)
  6. Lesson Six: Classification of Life (½ day)
  7. Lesson Seven: Characteristics of Bacteria & Viruses (1½ day)
  8. Lesson Eight: Complete the Story (½ day)
  9. Lesson Nine: Genetics and Epidemiology (2 days)

The Engineering Design Process

Activity Title: The Engineering Design Process – 8 Simple Steps

Overview: This lesson looks at the engineering design process. Specifically, it allows students to determine what the steps of the process are through their own discovery while also introducing students to the process in a more formal way. This is the first of two lessons designed to prepare students to develop a high level of confidence in their understanding and application of the engineering design process before applying it to the problem posed at the end of the unit — that of identifying potential issues with exploring other environments and planning solutions for worst-case scenarios.

Learning Objectives: Explore the "Engineering Design Process" through the discovery of the design process while creating the "perfect" paper airplane.

Materials:

  • Copy paper (8½” × 11”)
  • Paper clips
  • Transparent tape
  • Masking tape
  • Markers (or crayons)
  • Meter stick
  • Scissors
  • Interactive science notebook
  • Pen (or pencil)

Procedure:

ENGAGE

1. Give each student one sheet of copy paper and ask them if they know how to make a paper airplane. Should any student not know how, permit some guidance from classmates, but emphasize that this is an individual activity.

2. Guide a short discussion (1-2 min.) of what a "perfect" paper airplane is. Allow the students to determine the criteria for judging.

EXPLORE

3. Have the students fold their sheet of paper into the "perfect" paper airplane.

4. Once the planes are constructed, ask the students to spend the next 2-3 minutes personalizing their airplanes, but make sure their names are easy to see.

5. If your classroom is large enough (at least 15-20 ft.), move the desks out of the center of the room in order to create a "flight line" for the students to "pilot" their designs. (If space is not sufficient, go out into the hallway, but be attentive to your students’ volume).

6. Use a large strip (3-4 ft.) of masking tape to indicate the starting point.

7. Have groups of 3-4 students line-up along the tape and test their designs by "piloting" them across the "flight line."

8. As most students will determine that the "perfect" paper airplane is either the one that flies the straightest or the one that flies the furthest, have the first group use the meter stick to measure the distance their planes traveled or deviated from the path.

9. Have the first group pick up their airplanes and record their data on the whiteboard, chalkboard, or SmartBoard.

10. Repeat steps 7-8 with each subsequent group of students until all have had an opportunity to "pilot" their planes.

11. Once the initial data has been collected, inform the students that they will now have 5 minutes to revise their airplane designs in order to improve them. Let the students know that they can make ONE REVISION to their design by: 1) refolding, 2) adding material using paperclips or tape, or 3) removing material by cutting away paper or creating ailerons on the wings. Students may consult with teams that had more success.

EXPLAIN

12. Repeat the process once all revisions have been completed in order to collect a second set of data, and ask the students to determine if the revision did in fact make their design better.

13. Inform the students that they have just performed the job of an aerospace engineer and that now the class will work to discern what the process was.

14. Ask the students to get into their pre-assigned groups and give them 5 minutes to try to come up with the 8 steps of the engineering design process (this should be recorded in their journals along with the data they gathered earlier). Instruct the students that if they get stuck, they can send a "scout" to another group.

ELABORATE

15. While the students are working on creating the list and copying their data, begin creating an 8-blank list on the whiteboard, chalkboard, or SmartBoard.

16. Ask a few groups to share their lists and begin filling in the master list with their items.

17. Guide the students through uncovering the remaining steps of the "Engineering Design Process" using the attached handout.

EVALUATE

18. Once the list is complete, inform the students that they must now create a flowchart using the list on the board and the steps they performed in the paper airplane activity.

Assessment: The students will create a flowchart to illustrate their use of the "Engineering Design Process" in the design of the "perfect" paper airplane.

Worksheets/Handouts:

  • The Engineering Design Process – 8 Simple Steps

The Engineering Design Process - 8 Simple Steps

The engineering design process involves a series of steps that lead to the development of a new product or system. Engineering design involves the solving of a specific problem, and:

  • It is not a random process.
  • It incorporates a logical sequence of steps.

STEP 1: Identify the Problem

  • Who does this problem affect?
  • How will solving this problem benefit people?
  • What are some of the things I already know about this area?

STEP 2: Identify Criteria and Constraints

  • What is the required layout?
  • Which resources are available?
  • What is my schedule?
  • What direction do we want the project to go in, more product-based or proposal-based?
  • Are there any other constraints on what I can do with the design, such as safety issues?

STEP 3: Brainstorm Possible Solutions

  • Sketch a plan for how to run the project.
  • Identify roles and responsibilities for team members.
  • Share ideas about what the prototype product or proposal will look like.
  • Determine if there will be a theme or other marketing materials.

STEP 4: Generate Ideas

  • Choose two or three ideas to develop more thoroughly.
  • Create new drawings that show multiple views of the product (top, front, and one side) or probable layouts for the proposal (front page, table of contents, tables, graphs, text, etc.)
    • Drawings should be drawn neatly, using rulers to draw straight lines and to make parts proportional.
    • Parts and measurements should be labeled clearly.

STEP 5: Explore Possibilities

  • Share and discuss selected ideas and record the pros and cons of each design idea directly on the paper next to the drawings.

STEP 6: Select an Approach

  • The group should work in teams and identify the design that appears to solve the problem the best.
  • A written statement that describes why this design solution was chosen should be shared and include references to the criteria and constraints previously identified.
  • Chose the one design that best solves the problem.

STEP 7: Build a Model or Prototype

  • Construct a full-size or scale model based on the drawings.

STEP 8: Refine the Design

  • Examine and evaluate (test) the prototypes or designs based on the criteria and constraints.
  • Groups may enlist members from other groups to review the design and make suggestions.
  • Make recommendations for improvements or scrap the design and try another that was not previously chosen.

Junkyard Cars Launcher

Activity Title: Junkyard Cars Launcher

Overview: This lesson was designed as a follow-up to the "Engineering Design Process – 8 Simple Steps" lesson. Whereas the first lesson was designed to allow for the discovery of the process and a delineation of its steps, this one involves the students being given a specific problem to solve using the design process. The problem is such that the students can gain confidence in practicing the use of the process before tackling the more difficult problem of identifying potential issues with exploring other environments and planning solutions for worst-case scenarios.

Learning Objectives: Apply the Engineering Design Process to solving the real-world problem of moving junk cars across a great distance without the use of fossil fuels or other environmentally harmful materials. Explore the use of physical models and simulations in content-specific lessons/activities.

Materials:

  • Copy paper (8 ½” × 11”)
  • 3 foot wading pool
  • 19 7/8” × 11 7/8” × 1 3/16” × Styrofoam block
  • Matchbox cars
  • Duct tape
  • Rubber cement
  • Popsicle sticks
  • Masking tape
  • Markers (or crayons)
  • Meter stick
  • Protractor
  • Rubber tubing or rubber bands
  • Scissors
  • Interactive science notebook
  • Pen (or pencil)

Procedure:

EVALUATE

1. Students will be informed that this activity is a continuation of the previous lesson, and that they will now plan (using the engineering design process) a way in which to solve the problem as outlined in the attached RFP (Request For Proposals).

2. The teacher will assign students into groups that will spend the next two days working together. The students will be informed that they are responsible for determining who will participate in which specific role (recorder, reporter, design engineer, and construction foreman), but that all will be responsible for the project as a whole, and that they must help one another.

3. The teacher will facilitate each group as they work through the process of completing the written proposal, using the proposal to complete a testable prototype, and completing a summary report.

4. The teacher will remind students of the timeline requirements and the fact that they will be evaluating one another’s projects based on the selection criteria.

Assessment: Student evaluation of their own and others’ projects.

Worksheets/Handouts:

  • Request for Proposals (RFP) – Junkyard Cars Launcher form
  • Engineering Design Process Written Proposal form

Request for Proposals (RFP)

Engineering Design and Specifications: Junkyard Cars Launcher Project

Solicitation

Flying Cars, Inc., an international recycling business, is seeking an engineering firm to design a device to move reclaimed vehicles from several land-based salvage yards out to a water-based shipping facility for transport to a centralized recycling center. As most of the salvage yards are in locations that are inaccessible to large transportation equipment, the device must be able to accurately and consistently transport vehicles to a floating platform. The proposal of the winning engineering firm will receive a two-year contract for $500,000 plus expenses.

Restrictions and Limitations

  • All designs must be made using "green" technologies, so as to not increase the company’s carbon footprint.
    • As such, all designs may only use the following materials in construction of the device:
      • Copy paper (8 ½” × 11”)
      • Matchbox car
      • Duct tape
      • Rubber cement
      • Popsicle sticks
      • Masking tape
      • Markers (or crayons)
      • Meter stick
      • Protractor
      • Rubber tubing or rubber bands
      • Scissors
    • The device must be able to be operated by two individuals, a loader/shooter and a spotter.
    • The device cannot have a storage space requirement greater than 1 ft2.
    • The device should be able to be adjusted to accommodate vehicles from 35 g to 55 g.
    • The typical distance from a salvage yard to the floating platform is 2.5 ft.
    • All design teams must adhere to the engineering design process.

Design Selection Criteria

  • Each team will be given 1 minute to present its proposed design. Presentations should include the unique features of the design and the expected performance.
  • After the presentation, each team will be given 2 minutes to demonstrate its design. During the demonstration period, the team will be expected to deliver as many cars to the floating platform as possible. The platform will be set 2.5 feet away from a mock salvage yard.
  • Adjustments can be made to the launcher during the demonstration, but the clock will not be stopped.
  • The team that delivers the most cars to the mock platform is the winner.
  • In the event of a tie, the tying devices will each launch one car & the device whose car flies the longest and straightest distance will be declared the winner.

Engineering Design Process Written Proposal

Engineering Design and Specifications: Junkyard Cars Launcher Project

1. What is the problem that needs a solution? What do you know already about this topic?

\\\\\\

2. What are the specific criteria and constraints that must be followed during the design process?

\\\\\\

3. Who will perform which role? What are some possible ways to attack the problem?

\\\\\\

4. Create sketches of several prototypes from different angles (remember dimensions).

\\\\\\

5. Choose a design and indicate what specific aspects of the design fulfill the requirements.

\\\\\\

6. Which requirements weren’t met by these design choices? Why weren’t these addressed?

\\\\\\

Principles of Evolution by Natural Selection

Activity Title: Principles of Evolution by Natural Selection

Overview: This lesson was designed to reinforce the basic principles of the Theory of Evolution by Natural Selection. In particular, it utilizes a variety of techniques for student engagement, including the use of a multimedia PowerPoint presentation (not available here). Upon completion of the lesson, the student should be able to recall the basic principles of the theory, understanding that the changes that occur by natural selection (the outward physical characteristics) are a result of changes to the organisms’ genetic material (DNA).

Learning Objectives: Evaluate the significance of genetic changes in DNA (mutations) and how natural selection acts on the resulting physical changes to produce changes in populations, not individuals.

Materials:

  • Copy of the handout, "To Each His Own Environment"
  • Interactive notebook
  • Pen (or pencil)
  • PowerPoint presentation on evolution (not included)

Procedure:

ENGAGE

1. Students will be prompted to write down everything they know about the disease AIDS, and be given a 2-minute time limit.

2. At the end of the 2 minutes, students will be asked to share their lists with at least 2 other people in class, and add to or remove from their list as they talk to other students and see what others have written down.

3. The teacher will then randomly call on students to share their list, and poll the class to see how many other students had the same or similar items on their lists.

EXPLORE

4. The teacher will inform the students that they are about to watch a short video segment about new research into preventing AIDS, specifically regarding the cause of AIDS, the Human Immunodeficiency Virus (HIV).

5. Students will view the video segment, "HIV Immunity" from the PBS website: http://www.pbs.org/teachers/connect/resources/5275/preview/. As they are watching, the teacher will ask the students to write down what they believe are the key points of the video for a discussion that will follow.

EXPLAIN

6. The teacher will ask for a volunteer student to say one thing they wrote down as a key point about the video they just watched, and will then ask for additional volunteers to add just one more thing. As the students are calling off things, the teacher will be writing them down on the Smart Board.

7. The teacher will ask students, "What are CD-4 and CCR5?" He/she will coach students into understanding that these are proteins on the surface of immune system cells that are required for infection by HIV.

8. Students will then be asked to explain, "Where do these proteins come from?" This should lead to the teacher coaching the students into remembering that proteins come from mRNA molecules that are derived from genes in their DNA. Specifically, the students need to understand that the name CCR5 is used interchangeably to refer to the gene AND the protein.

9. The teacher will then ask the students, "Why do certain people have a natural immunity to HIV?" Students need to make the connection that these people have a mutated version of the CCR5 gene that makes the protein that doesn’t bind to the virus, and therefore prevents infection.

10. The students will then be asked, "Does anyone remember the percentage of people that are estimated to carry the mutation in the CCR5 gene as well as which race of people they are?"

11. The teacher will ask the students to pair off and answer the question, "Why do you think such a small percentage of people carry this mutation, and why only Caucasians?" The students will be asked to come up with one answer between each pair and write it on one of their mini white boards. The teacher will ask to the students to hold up their white boards simultaneously to poll the class.

12. Regarding the previous question, the students will need to be reminded of the "Out of Africa" hypothesis, wherein it is believed that modern humans originated in the African continent some 150,000 – 200,000 years ago and began migrating to the other continents between 60,000 – 125,000 years ago. They should also be reminded that one of the suppositions that came from that hypothesis was that distinct races developed as a result of geographic isolation and the effect of differing environmental factors. The students should understand that the group of humans that make up the European Caucasians could have developed mutations that would not have been found in other groups.

13. The teacher will then ask, "Are all mutations bad? If not, what reasons can you come up with for why a mutation would be good?" The students need to understand that not all mutations are bad and that the "good" ones are considered as such because they impart a "selective advantage" by increasing the "fitness" of the individuals that carry that mutation. As an example, inform the students that it is believed that the mutation that imparts immunity to HIV was introduced over 700 years ago in an area of Europe where the bubonic plague was wreaking havoc on the population, and that this mutation remained in the population because it increased the "fitness" of individuals in the area, protecting them from the plague.

ELABORATE

14. The students will be instructed to take out their interactive notebooks in order to take notes regarding the Theory of Evolution by Natural Selection. The teacher will go through the presentation, making sure that the key points of the theory are emphasized.

EVALUATE

15. The students will take what they know of the theory, and the concept of fitness in particular, to complete the handout, "To Each His Own Environment." The teacher will provide the students with the following list of organisms for them to use in completing the handout. Students will choose one animal, one plant, and one microorganism:

a. Animals – polar bear, leafy seadragon, hagfish, platypus, and vampire bat

b. Plants – pitcher plant, cactus, waterlilly, pine tree, and poison ivy

c. Microorganisms – Thermus aquaticus, Dictyostelium slime mold, halophilic bacteria, and fly agaric mushroom

Assessment: "To Each His Own Environment"

Worksheets/Handouts:

  • To Each His Own Environment

To Each His Own Environment

You have learned that organisms are adapted in ways that make them more likely to survive in their environments, but what happens if those environments change? Use your textbook and other references to complete the Table below.

To Each His Own Environment
Organism Environment in Which the Organism Lives Adaptations for Survival Environments organism would not survive in and why

A Natural Selection Simulation – Option I

Activity Title: A Natural Selection Simulation

Overview: In order for students to be able to come to the conclusion that small changes in an ecosystem can have long-term effects, they must first review the concepts of natural selection as well as be able to recall information about food chains and the interplay of the organisms within ecosystems. This lesson is integrated into the unit at this point in order to help students focus on population dynamics and how changes within an ecosystem affect the way the ecosystem functions; it also introduces modeling and simulation in lesson activities.

Learning Objectives: Review the principles of evolution by natural selection as they apply to population dynamics and long-term effects. Explore the use of physical models and simulations in recalling natural selection concepts as they will eventually apply to the unit problem.

Materials:

  • 6 plastic sandwich bags, each labeled "Beginning Population" and containing 20 each of the orange, yellow and green dots
  • 6 plastic sandwich bags, each labeled "Survivors and Their Offspring"
  • 18 sandwich bags, each labeled "Extra Dots Bag" and containing 20-30 each of the different colored dots
  • 6 pieces of autumn leaf-patterned fabric: 40 cm × 40 cm (these will be the habitats)
  • 18 colored pencils or markers (3/group)
  • 6 stop watches
  • Several sheets of graph paper

Procedure:

ENGAGE

1. Greet each student at the door and offer a bowl containing a mixture of candy corn and M&Ms. Tell the students to only take five M&Ms but no candy corn. As the students select their candy, tell them that they will be allowed to eat them after the start-up activity.

2. Once each student has chosen his or her candy, use your SmartBoard to create a table of values regarding how many M&Ms of each color were picked.

3. Analyze the data with the students and ask them why they think the results came out as such. In the conversation that ensues, let the students know that these candy pieces represent organisms with different versions of a particular trait. Ask the students to consider what this means regarding the interactions among the individuals in the population as well as between the group and other organisms. They should conclude that as there are increased numbers of individuals with greater fitness, the populations of organisms above and below them on the food chain with be affected either positively or negatively.

EXPLORE/EXPLAIN

4. Inform students that they are going to simulate natural selection in a population and that the colored dots represent individual organisms displaying different versions of a given trait.

5. Have the students get into their pre-assigned groups of three and hand each group one set of the aforementioned materials as well as the "A Natural Selection Simulation – Option I" Handout.

ELABORATE

6. Students will work in to complete the activity with the teacher monitoring student progress and facilitating student understanding of what the implications are for the population dynamics within the ecosystem the dots live in.

EVALUATE

7. Once the students have completed the activity, assess student understanding using the "Formative Assessment #1."

Assessment "Formative Assessment #1"

Worksheets/Handouts:

  • “A Natural Selection Simulation – Option I” Handout
  • Formative Assessment #1 Handout

A Natural Selection Simulation

Objective

Students will observe and analyze simulations of the principle of natural selection.

Key Understanding(s)

  • The most "fit" organisms will survive and pass on their genes to the next generation.
  • Natural selection plays a vital role in speciation.
  • Adaptations are inherited characteristics that increase an organism’s ability to survive and reduce its chances of extinction.
  • Fossil records show how organisms have changed over time.
  • DNA sequences as well as physiological and anatomical similarities are used to determine how organisms are related.

Materials: (per group)

  • 1 plastic sandwich bag, labeled "Beginning Population" and containing 20 each of the orange, yellow, and green dots
  • 1 plastic sandwich bag, labeled "Survivors and Their Offspring"
  • 3 bags, labeled "Extra Dots Bag" and containing 20-30 each of the different colored dots.
  • 1 piece of autumn leaf-patterned fabric approx. 40 cm × 40 cm (this will be the "habitat")
  • Stop watch
  • 3 colored pencils or markers
  • Graph paper

Procedures:

1. Designate a "game warden," a recorder, and a "predator" in each group.

2. Spread your fabric "habitat" on a flat surface.

3. While the predator has his/her back turned, the game warden distributes the "prey" (dots) from the "Beginning Population" bag across the habitat.

4. When the game warden says, "Go!" the predator should turn around, face the habitat, and pick up as many "prey" as he/she can in 10 seconds. PREDATORS CAN PICK UP ONLY ONE DOT AT A TIME, USING ONLY ONE HAND. The game warden should monitor that no scooping or grabbing of several dots occurs.

5. AFTER Predation I is completed, students should gather the surviving dots (any dots left on the fabric) and sort and count them by color.

6. The recorder should enter the number of Surviving Predation I dots by color in the data table.

7. Dots picked up during Predation I should be returned to the "Beginning Population" bag.

8. Place the Surviving Predation I dots in the "Survivors and Their Offspring" bag.

9. For every surviving dot, select a dot of the same color from the "Extra Dots" bag and place it into the "Survivors and Their Offspring" bag.

For example, if:

  • 5 orange dots survived, 5 new orange dots should go into the "Survivors and Their Offspring" bag.
  • 8 green dots survived, 8 new green dots should go into the "Survivors and Their Offspring" bag.
  • 10 yellow dots survived, 10 new yellow dots should go into the "Survivors and Their Offspring" bag.

10. The recorder should write the total number of each color of added offspring in the Offspring I column of the data table.

11. While the predator turns his/her back again, the game warden distributes the dots from the "Survivors and Their Offspring" bag across the habitat.

12. STEPS 5-11 SHOULD BE REPEATED TWO MORE TIMES, SIMULATING PREDATION II AND III.

Survivors & Offspring Table
Dot Color Beginning Population Survivors Predation I Offspring Predation I Survivors Predation II Offspring Predation II Survivors Predation III Offspring Predation III
Orange 20
Green 20
Yellow 20

13. Construct a bar graph using a separate sheet of graph paper or the graph on the last page of the student handout to show the changes from the original population to Offspring I, II, and III. Use the colored pencils or markers to color code the different data sets.

Natural Selection Questions

  1. What do the dots represent in this simulation?
  2. Who were the predators? Which organisms in the environment did they represent?
  3. What represents the natural selection pressure?
  4. Name a few examples of other types of natural selection pressures.
  5. What is the adaptation mechanism of the prey?
  6. Which color of dots increased in frequency and why did this happen?
  7. Which color of dots decreased in frequency and why did this happen?
  8. If the dots were real organisms, what color would the parents of the fifth generation most likely be?
  9. Predict what you think would happen if this simulation were to continue for three more generations.

Natural Selection Questions - ANSWER KEY

  1. They represent organisms, with different variations of a particular trait, in an environment.
  2. The students assigned as "predators" represented top-level carnivores such as wolves, lions, hawks, humans, etc.
  3. The predation of the "organisms" by the "predators"
  4. (Answers may vary) Susceptibility to illness, competition for limited resources, etc.
  5. They are seeking out prey that has a coloration that is easily seen in the context of the surrounding environment.
  6. (Answers may vary) The green-colored dots increased in frequency because their coloration was such that they were camouflaged in their environment.
  7. (Answers may vary) The yellow-colored dots decreased in frequency because their coloration was such that they stood out in their environment.
  8. (Answers may vary) Green
  9. Most of the yellow and all of the orange "organisms" would be gone.

A Natural Selection Simulation – Option II

Activity Title: A Natural Selection Simulation

Overview: In order for students to be able to conclude that how small changes in an ecosystem can have long-term effects, they must first review the concepts of natural selection. They must also be able to recall information about food chains, the interplay of the organisms within ecosystems, and how genetic changes can have profound effects within an ecosystem. This lesson is integrated into the unit at this point in order to 1) demonstrate to students how allelic frequencies within a population change; 2) help students analyze how changes in allelic frequencies affect the populations within an ecosystem; and 3) introduce modeling and simulation in lesson activities.

Learning Objectives: Review the principles of evolution by natural selection as they apply to population changes resulting from altered allelic frequencies and the long-term effects to ecosystems as a result of the changes to individual populations. Explore the use of physical models and simulations in recalling natural selection and genetics concepts as they will eventually apply to the unit problem.

Materials:

  • 12 brown paper bags, each with one die and 50 miniature popsicle sticks (25 sticks with the letter "R" on them and 25 with the letter "r").
  • 100 miniature popsicle sticks (50 with the letter "R" and 50 with the letter "r")
  • Pen (or pencil)
  • "A Natural Selection Simulation – Option II" Handout

Procedure:

ENGAGE

1. Greet each student at the door and offer a bowl containing a mixture of candy corn and M&Ms. Tell the students to take only five M&Ms but no candy corn. As the students select their candy, tell them that they will be allowed to eat them after the start-up activity.

2. Once every student has chosen their candy, use your SmartBoard to create a table of values regarding how many M&Ms of each color were picked.

3. Analyze the data with the students and ask them why they think the results came out as such. In the conversation that ensues, let the students know that these candy pieces represent different alleles of a specific gene. Ask the students to consider what this means regarding the variability of the traits that are seen within a population. They should conclude that there is decreased variability, so the population appears to be more uniform.

EXPLORE/EXPLAIN

4. Inform students that they are going to simulate natural selection in a population and that the mini popsicle sticks represent chromosomes containing different alleles for a gene responsible for determining how fast mice can run.

5. Have the students pair up with their "clock partners" and hand each pair a brown paper bag with the aforementioned materials as well as the "A Natural Selection Simulation – Option II" Handout.

ELABORATE

6. Students will work in pairs to complete the activity with the teacher monitoring student progress and facilitating student understanding of what the implications are for the population dynamics within the ecosystem the mice live in.

EVALUATE

7. Once the students have completed the activity, assess student understanding using the "Formative Assessment #1."

Assessment: "Formative Assessment #1"

Worksheets/Handouts:

  • “A Natural Selection Simulation – Option II” Handout
  • Formative Assessment #1 Handout

A Natural Selection Simulation

INTRODUCTION

For the next couple of days, we are going to simulate the process of natural selection in a population. Specifically, we are going to look at a population of mice, and we are going to pretend that only one gene determines how fast a mouse can run. Obviously, the speed at which a mouse can run is a trait that has many contributing factors, both genetic and environmental; however, for this simulation we are going to ignore the environmental factors and simplify the genetics. For our simulation we will be studying the effects of natural selection on the allele variations of the mythical "run speed gene." Here are the possible genotypes for each mouse in a population, and the phenotype that results from each:

Possible Genotypes for Mouse
Genotype Phenotype
RR Very fast runner – almost always escapes the predator
Rr Fast runner – sometimes escapes the predator
rr Very slow runner – rarely escapes the predator

In this scenario you can infer that those mice that run faster (and by extension those mice with the dominant allele) are more likely to outrun a predator. Because organisms with this given adaptation are more likely to survive and reproduce, their genes will be passed on to the next generation, thus increasing the frequency of the gene that caused the adaptation. In this way populations change over time or evolve, but individual organisms themselves do not evolve. (NOTE: even though here the presence of dominant alleles is advantageous, dominant alleles do not always lead to an advantage; sometimes being homozygous recessive for a trait is advantageous.)

PROCEDURES

1. To begin this simulation, students will randomly choose another student to "mate" with (or alternatively the teacher may pair students up).

2. Each pair of students will receive a brown paper bag with one die and 50 miniature popsicle sticks (25 sticks with the letter "R" on them and 25 with the letter "r"). These sticks represent the chromosomes of all the individuals within a given population with a specific allele (R or r).

3. To simulate the process of reproduction, each student will reach into their bag, one at a time, and choose one stick at random. The letter combination that is shown by the two sticks represents the genotype of the first offspring.

4. Record this genotype in the "Round 1" offspring table on page 2.

5. Return the sticks to the bag and shake it.

6. Both you & your partner will now choose another pair of sticks from the bag, and record this genotype as that of offspring two.

7. Return the sticks to the bag, and continue this process until you have chosen 20 offspring.

8. Now your group must determine the fate of each offspring as they are preyed upon by an owl. To simulate that other factors play a part in the ability of a mouse to escape a predator besides how fast they run (and therefore which alleles they have), you are going to roll a die. Survival of each offspring will depend on both their genotype and what you roll. Use Table below to determine if the offspring survive predation each time they are preyed upon.

If you roll a ____________, then you___________.
Genotype 1 2 3 4 5 6
RR Escape Escape Escape Escape Escape Die
Rr Escape Escape Escape Die Die Die
rr Escape Die Die Die Die Die

9. Record the number on the die from each roll on the offspring table as well as the result of the predation event.

ROUND 1
Offspring # Genotype Roll Result
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20

10. Once you have completely filled in the data table, you must determine how many offspring survived of each genotype. Draw a single, thin line through any offspring that died following predation, as they are not affected by natural selection.

11. Next, count the number of offspring that survived with the RR, Rr, and rr genotypes, and record these numbers in the Table below.

Round 1
# of Survivors with a Specific Genotype
RR
Rr
rr

12. Now you need to determine the percentage of each allele for any surviving offspring from Round 1. Use the formulas below, and enter these values in the summary data: Table below.

# of R alleles = (# of RR Survivors × 2) + # of Rr Survivors

# of r alleles = (# of rr Survivors × 2) + # of Rr Survivors

Total # of alleles = # of R alleles + # of r alleles

% of R alleles = # of R alleles / Total number of genes × 100

% of r alleles = 100% - % of R alleles

13. To prepare the bag for Round 2, remove all 50 sticks and separate them into two piles by letter.

14. Use the values calculated for the number of R alleles and the number of r alleles to determine how many sticks of each type to put back in the bag. Based on these calculations, you may end up: 1) replacing all the sticks in the bag, 2) putting only a few of them in the bag, or 3) not having enough sticks. In case your group finds itself faced with situation #3, you will need to borrow some from the teacher to have the correct numbers of each type.

15. Now that the bag is ready, your group needs to repeat the procedure from step #3 – #14 twice more to collect data for Round 2 and Round 3. Use the tables, formulas, and spaces provided on the following pages to fill in that data.

ROUND 2
Offspring # Genotype Roll Result
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
Round 2
# of Survivors with a Specific Genotype
RR
Rr
rr

# of R alleles = (# of RR Survivors × 2) + # of Rr Survivors

# of r alleles = (# of rr Survivors × 2) + # of Rr Survivors

Total # of alleles = # of R alleles + # of r alleles

% of R alleles = # of R alleles / Total number of genes × 100

% of r alleles = 100% - % of R alleles

ROUND 3
Offspring # Genotype Roll Result
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
Round 3
# of Survivors with a Specific Genotype
RR
Rr
rr

# of R alleles = (# of RR Survivors × 2) + # of Rr Survivors

# of r alleles = (# of rr Survivors × 2) + # of Rr Survivors

Total # of alleles = # of R alleles + # of r alleles

% of R alleles = # of R alleles / Total number of genes × 100

% of r alleles = 100% - % of R alleles

SUMMARY

Round # of R alleles # of r alleles Total # of alleles % of R alleles % of r alleles Ratio of R:r alleles
Initial 25 25 50 50% 50% 1:1
1
2
3

QUESTIONS

  1. What is the advantage of being a mouse with at least one dominant gene for speed?
  2. According to the information in Table above regarding offspring genotype and die roll, what are the odds of each type of mouse escaping the predator?

RR &=\\Rr &=\\rr &=

  1. What do the "R" and "r" sticks represent?
  2. Natural selection occurs because an adaptation exists that gives some members of a species a better chance of surviving and reproducing than others (referred to as "fitness"). What was the natural selection pressure acting on the "fitness" of the mice?
  3. Which allele (R or r) increased in frequency (meaning the percentage of that gene increased)? Why do you think that allele increased in frequency in the population?
  4. Did the other allele completely disappear from the population? Why or why not?
  5. What do you predict would happen to the percentage of R and the percentage of r if we carried out this simulation three more times?

QUESTIONS - ANSWER KEY

  1. An organism with at least one dominant gene for speed has the ability to fun fast and will, more often than not, escape from a predator.

RR &= \frac{5}{6}(83\%)\\Rr &= \frac{3}{6}(50\%)\\rr &= \frac{1}{6}(17\%)

  1. Chromosomes with a specific allele for the "run speed gene" found in the population being studied.
  2. Predation by organisms higher up on the food chain than the mice.
  3. R – the presence of that allele, even in the heterozygous condition, imparts a selective advantage as it increases the fitness of the organism.
  4. No – the allele didn’t completely disappear, as it stayed "hidden" in the heterozygous state.
  5. The percentage of R alleles would begin to approach a maximum while the percentage of r alleles would approach a minimum, but neither would completely take over or disappear.

Formative Assessment #1

  1. In science, theories are:
    1. an educated guess
    2. a known fact
    3. absolute and unchangeable
    4. the best explanation for data
  2. Which of the following is NOT a component of the Theory of Evolution?
    1. competition for food and space
    2. variation among species
    3. inheritance of acquired traits
    4. survival and reproduction
  3. Any adaptation that can increases an organism’s ability to survive increases its:
    1. fitness
    2. characteristic
    3. competition
    4. adaptation
  4. The finches on the Galapagos Islands were similar in form except for variations of their beaks. Darwin observed that these variations were useful for:
    1. attracting a mate
    2. defending territory
    3. building nests
    4. gathering food
  5. Which of the following is LEAST likely to affect the genetic equilibrium of a population?
    1. migration
    2. selective mating
    3. population size
    4. mutation
  6. Natural selection operates only on an individual's
    1. gene pool
    2. gene frequency
    3. phenotype
    4. genotype
  7. Speciation cannot take place without
    1. homologous structures
    2. disruptive selection
    3. geographic isolation
    4. reproductive isolation
  8. Most genetic variation is due to
    1. mutation & natural selection
    2. mutation & genetic shuffling
    3. artificial selection & natural selection
    4. founder effects & sexual recombination
  9. Which of the following is most characteristic of a dominant gene?
    1. It masks the effects of other alleles
    2. Its effects are masked by other alleles
    3. It always produces only one phenotype
    4. It’s always the most prevalent in a gene pool
  10. If a plant that is heterozygous for tallness (Tt) is crossed with a homozygous tall plant (TT), which could not be among the offspring?
    1. All tall plants
    2. A Tt plant
    3. A TT plant
    4. A tt plant

Formative Assessment #1 - ANSWER KEY

  1. d. the best explanation for data
  2. c. inheritance of acquired traits
  3. a. fitness
  4. d. gathering food
  5. d. mutation
  6. c. phenotype
  7. c. geographic isolation
  8. a. mutation & natural selection
  9. a. It masks the effects of other alleles
  10. d. A tt plant

Mutations and Natural Selection

Activity Title: Mutations and Natural Selection

Overview: This lesson was designed to reinforce the understanding that natural selection acts on physical characteristics that are the result of changes (mutations) to the genetic material (DNA) that is found in cells. It also introduces the use of computer-generated models/simulations in exploring the effects of mutations and how natural selection acts upon them. In particular, this lesson focuses on how mutations can have varying degrees of effect (from beneficial to lethal) on a population, depending upon the specific mutation and the environmental circumstances the organisms live in. The lesson also focuses on how these mutations are passed on through generations.

Learning Objectives: Evaluate the significance of changes in DNA and how natural selection acts on changes in DNA to produce change in populations, not individuals. Explore the use of computer-generated models and simulations in content-specific lessons/activities. Evaluate models according to their limitations in representing biological objects or events.

Materials:

  • "Mutations and Natural Selection" Handout
  • Pen (or pencil)
  • Smart Board interactive whiteboard & Smart Notebook software
  • 12 Internet-ready computers (Mac or PC)

Procedure:

ENGAGE

1. Show the students the following YouTube video, which discusses the dangers of skin cancer: http://www.youtube.com/watch?v=_4jgUcxMezM.

2. Following the video, ask the students to write down 10 things they know about skin cancer. Tell them they are allowed to check answers with the other students in the class, but each answer must be unique.

EXPLORE/EXPLAIN

3. Once each student has had an opportunity to get at least 6-7 items on their list, have the students come up to the Smart Board to work collaboratively from their lists to complete the "Skin Cancer" activity found on the Smart Exchange website: http://exchange.smarttech.com/index.html#tab=0. To find the notebook file, search for the title of the activity on the website.

ELABORATE

4. Before students begin the "Mutations and Natural Selection" activity, the teacher (or the students) will need to go to both the Molecular Workbench website http://workbench.concord.org/database/activities/102.html and the PhET website http://phet.colorado.edu/en/simulation/natural-selection in order to download the "DNA Mutations" and "Natural Selection" Java applets onto each computer that will be used.

5. Once loaded, the teacher will assign partner groups and have the students work through the activity using the computer simulation. It is imperative that the teacher rotate around the room, ensuring that students understand what is happening at each step of the process (i.e. select a pair of individuals randomly, translate their DNA into proteins, assess if they carry the mutation and their risk, perform the test cross, determine offspring survivability, etc.)

EVALUATE

6. Once the students have completed the activity, assess student understanding by having them speculate on the following scenario: "Knowing what we know today, it is believed that the mutation that causes sickle-cell anemia developed several thousand years ago, and while fatal to the individual in the homozygous state, was maintained in a population of sub-Saharan humans because the presence of the mutation in the heterozygous state imparted an increased resistance to malaria. Research shows that the protists that are transmitted through a mosquito bite need to develop in the red blood cells of the host and cannot because of the sickle-cell's shape. What would happen if the protists suddenly developed a mutation that allowed them to develop in white blood cells instead?"

Assessment: The students will speculate, in writing, as to what would happen given a similar scenario in which natural selection would be allowed to act upon a population wherein a mutation was introduced. They would then evaluate one another’s writings to judge whose is the most plausible.

Worksheets/Handouts:

  • “Mutations and Natural Selection” Handout

Mutations and Natural Selection

A mutation is a change in the DNA molecule, the hereditary material of life found in every one of our cells. An organism’s DNA affects how it looks, how it behaves, and its physiology, so any change in an organism’s DNA can cause changes in all aspects of its life. Changes to the DNA of an organism are called mutations. They can be helpful, neutral, or harmful for the organism. Mutations do not necessarily supply what the organism "needs," but instead occur regardless of how useful that mutation could be. In other words, mutations are random.

Since all cells in our body contain DNA, there are lots of places for mutations to occur; however, not all mutations matter when considering the process of evolution. Mutations that occur in our somatic (body) cells aren’t passed onto offspring, but those that occur in reproductive cells like eggs and sperm are called germ line mutations and can be passed on from parent to offspring.

Here we will be looking at two genes (BRCA1 & BACH1) that are passed on from parent to child, and when mutated are known to increase or decrease the risk of developing breast cancer in both men and women and ovarian cancer in women.

BRCA1 (BReast CAncer gene 1): Human tumor suppressor gene that produces a protein called breast cancer type 1 susceptibility protein. BRCA1 is expressed in the cells of the breast, ovaries, and other tissues, where it helps repair damaged DNA, or destroy cells if DNA cannot be repaired. If BRCA1 itself is damaged, damaged DNA is not repaired properly and this increases cancer risks.

Gene region sequence: GCTGCTTGTGAATTTTCTGAGACGGATGTA

Protein region sequence: Ala-Ala-Cys-Glu-Phe-Ser-Glu-Thr-Asp-Val

BACH1 (BTB And CNC Homology gene 1) Human transcriptional regulator gene that acts as a repressor or activator of other genes, including BRCA1. Certain mutations of BACH1 lead to defects in the DNA repair mechanism, and result in an increased risk of breast and ovarian cancer. Other mutations of this gene have been found, however, that show an increase in its protective effect, offsetting the effects of BRCA1 mutations.

Gene region sequence: GTGACAGTTAAAGGATTTGAACCTTTAATT

Protein region sequence: Val-Thr-Val-Lys-Gly-Phe-Glu-Pro-Leu-Ile

____________________________________________________________

Mutations of BRCA1 that increase the risk of breast & ovarian cancer by 50%:

Ala-Ala-Cys-Glu-Phe-Ile-Glu-Thr-Asp-Val

Mutations of BACH1 that increase the risk of breast & ovarian cancer by 50%:

Val-Thr-Val-Met-Gly-Phe-Glu-Pro-Leu-Ile

Mutations of BACH1 that decrease the risk of breast & ovarian cancer by 50%:

Val-Thr-Val-Lys-Gly-Phe-Gly-Pro-Leu-Ile

Scenario

In 2025, a series of earthquakes struck along the Pacific Rim, much like the earthquakes that hit Japan in March and April of 2011, causing damage to numerous nuclear power plants and resulting in massive amounts of nuclear fallout being released into the atmosphere. Initial reports showed the concentrations to have been too low to be of much concern. However, in the months following this event, epidemiologists tracked a significant increase in the number of cases of cancer being reported as well as a significant decrease in the birthrate. It was suggested that the radiation affected a large proportion of the population, resulting in increased infertility rates. Knowing that conservative estimates of the numbers of unaffected individuals may be in the hundreds (classifying our species as endangered), the World Health Organization (WHO) began conducting voluntary testing of individuals to see if any had been spared and could be asked to participate in the process of helping ensure the survival of the human race. Only 12 individuals (6 males and 6 females) were found to be free from radiation poisoning. They will have to save our species — if only they can survive their own built-in genetic flaws.

Instructions

1) Below are the genetic profiles for the 6 men and 6 women. You will roll a die to see which pair you will be studying, and then determine the increased or decreased risk of them developing breast (ovarian) cancer using the "Molecular Workbench DNA Mutation Simulator."

a) Enter (one at a time) the DNA sequence for each of the normal genes into the simulator using the text edit button, and then transcribe & translate the DNA sequences into proteins.

b) Take a snapshot of the normal proteins that are produced and provide a short descriptor for each image.

c) Enter (one at a time) the DNA sequence for each of the genes that your couple carries, and take a snapshot of the proteins that are produced, again remembering to provide a short descriptor for each image.

d) Compare the proteins that are produced to the normal ones to determine if either member of your couple carries a variant allele.

2) Determine the genotypes for your two humans, using B and b for the normal and cancer-causing alleles for the BRCA1 gene, and C, c^+, and c^- for the normal, beneficial, and cancer-causing alleles for the BACH1 gene. Assume all cases are either "homozygous normal" or "homozygous mutant." Record these on your answer sheet.

3) Set up the dihybrid cross to estimate how many of children from your pairing are likely to carry any of the aberrant genes (assume your couple has 16 children).

Genetic Profiles

Persons chosen:
Genotypes of parents:
Overall risk:

Punnett Square

Initial Numbers of Offspring (by genotype):
# with neither mutation (BBCC):
# with BRCA1 mutation only ('BbCC/bbCC):
# with BACH1+ mutation only (BBCc+/BBc+c+):
# with BACH1- mutation only (BBCc-/BBc-c-):
# with BRCA1 and BACH1+ mutation (BbCc+/Bbc+c+/bbCc+/bbc+c+):
# with BRCA1 and BACH1- mutation (BbCc-/Bbc-c-/bbCc-/bbc-c-):

4. We will now simulate the process of natural selection using another simulator, the "PhET Natural Selection Simulator." While this application looks at the natural selection of rabbits, we will adapt our scenario in order to use this tool so that the "rabbits" are the offspring of our cross, and the "wolves" are the environmental factors that reduce survival. Here we will look at two traits in the "rabbits": fur color and tail length.

a) Open the Java Applet from the desktop, and "pause" it to set up the scenario.

b) Set the environment to "Arctic," click on the "Add a friend" button, and select the "Brown Fur" mutation. Make sure that "Brown Fur" is the dominant trait.

c) Allow the population to grow once, and then add the "Long Tail" mutation, again remembering to make sure that it is the dominant trait.

d) Allow the population to grown three times more.

e) Now select "Wolves" as the selection factor, allow the simulation to go through 3 more rounds of natural selection, and pause the application again.

f) Re-size your graph by using the "Zoom" button in order to see all the data, and then capture an image of your graph using the "Print Screen" option. This will copy your screen onto the computer’s clipboard so it can be pasted below.

Graph of Survivors (by phenotype):

\\\\\\\\\\

g) Adjust the image so only the graph shows (i.e. crop out the rest of the picture).

h) Based on the numbers of rabbits that remain, correlate this back to our breast cancer scenario using the Table below. Determine if our species would survive or go extinct:

Rabbit Genotypes and Phenotypes
Genotype(s): Rabbit Phenotype(s):
BBCC, BBCc+, BBc+c+ White fur / short tail
BbCc+, Bbc+c+, bbCc+, bbc+c+ White fur / long tail
BbCC, bbCC, BBCc-, BBc-c- Brown fur / short tail
BbCc-, Bbc-c-, bbCc-, bbc-c- Brown fur / long tail
Number of Survivors (by phenotype):
Neither mutation or BACH1+ only (BBCC, BBCc+, BBc+c+)
BRCA1 and BACH1+ (BbCc+, Bbc+c+, bbCc+, bbc+c+)
BRCA1 or BACH1- (BbCC, bbCC, BBCc-, BBc-c-)
BRCA1 and BACH1- (BbCc-, Bbc-c-, bbCc-, bbc-c-)

What do you predict will happen to the make-up of the population if this process continued?

Classification of Life

Activity Title: Classification of Life

Overview: This lesson is designed to introduce students to the Linnaean classification and binomial nomenclature systems, which provide a common language for organizing living organisms based on the similarities and differences shared among them. In particular, this lesson takes advantage of the Smart Board interactive whiteboard and Smart Slate equipment.

Learning Objectives: Compare characteristics of taxonomic groups, including archaea, bacteria, protists, fungi, plants, and animals. Categorize organisms using a hierarchical classification system based on similarities and differences shared among groups.

Materials:

  • Internet-ready computer with Smart Notebook software pre-loaded
  • Smart Board interactive whiteboard
  • Smart Slate
  • Interactive notebook
  • Pen (or pencil)

Procedure:

ENGAGE

1. Show the students a group of different types of organisms. Ask the students to organize them into 3 distinct groups by putting the names of the organisms into three lists. Guide the students through the process of recognizing the common characteristics of each of the organisms and have a couple of them use the Smart Board to manipulate the pictures to form the groups.

2. Explain to the students that what they just did was to compare and contrast the physical characteristics of several things in order to organize them and group them logically. Inform the students that the day’s lesson will be about how scientists organize things.

EXPLORE/EXPLAIN/ELABORATE

3. Use the Smart Board activity to guide students through the process of learning about taxonomy and classification. In order to complete it, go to the Smart Exchange website: http://exchange.smarttech.com/index.html#tab=0, and search for "Taxonomy & Classification" on the website. The students will be passing the Smart Slate around during the activity or interacting directly with the Smart Board. While working on the activity, tell the students that they should be taking notes in their interactive notebooks about the key points of the activity.

EVALUATE

4. Once the students have completed the activity, assess student understanding by having them use their notes to complete the "Classification Graphic Organizer."

Assessment: Individual students will complete a graphic organizer over the 3 domains and 6 kingdoms.

Worksheets/Handouts:

  • Classification Graphic Organizer Handout

Classification Graphic Organizer

Classification Graphic Organizer: KEY

Characteristics of Bacteria and Viruses

Activity Title: Characteristics of Bacteria and Viruses

Overview: This lesson gives a basic overview of the characteristics of bacteria and viruses, including their shapes, habitats, reproduction, and nutrition. Like the "Classification of Life" lesson, this one also takes advantage of the Smart Board interactive whiteboard and Smart Slate equipment.

Learning Objectives: Categorize bacteria and viruses using a hierarchical classification system based on similarities and differences shared among groups.

Materials:

  • Internet-ready computer with Smart Notebook software pre-loaded
  • Smart Board interactive whiteboard
  • Smart Slate
  • Interactive notebook
  • Pen (or pencil)

Procedure:

ENGAGE

1. Show the students the news report "Cell Phone Bacteria" from KOB-TV in Albuquerque, New Mexico, by downloading it from YouTube at: http://www.youtube.com/watch?v=4lmwbBzClAc. Ask the students, upon completion of the video, if they clean their own cell phones (then offer them some alcohol or Clorox© wipes to clean them).

2. Explain to the students that two things were mentioned in the video, Staph and herpes. Show the students pictures of individuals that have these infections and then ask them, "Do any of you know what type of organism causes these infections?" Guide the students to understanding that one is caused by a bacteria and one by a virus, and that bacteria and viruses will be the topic of discussion for the day.

EXPLORE/EXPLAIN/ELABORATE

3. Use the Smart Board activity to guide students through the process of learning about bacteria and viruses. In order to complete it, go to the Smart Exchange website: http://exchange.smarttech.com/index.html#tab=0, and search for "Bacteria & Viruses" on the website. The students will be passing the Smart Slate around during the activity or interacting directly with the Smart Board. While working on the activity, tell the students that they should be taking notes in their interactive notebooks about the key points of the activity.

EVALUATE

4. Once the students have completed the activity, assess student understanding by having them use their notes, textbook, and other Internet resources of their choosing to complete the "Bacteria and Viruses Comparison Table."

Assessment: Individual students will complete the "Bacteria and Viruses Comparison Table."

Worksheets/Handouts:

  • Bacteria & Viruses Comparison Table Handout

Bacteria and Viruses Comparison Table Hndout

Bacteria and Viruses Comparison Table
Bacteria Virus
Nucleus
Reproduction
Can cause disease?
Ribosomes
Structures
Living Attributes
Infection
Enzymes
Size
Beneficial
How treated?
# of cells
Bacteria and Viruses Comparison Table: KEY
Bacteria Virus
Nucleus No No, they have no cells
Reproduction Fission, conjugation & spore formation Dependent on host cell machinery
Can cause disease? Yes Yes
Ribosomes Yes No
Structures DNA & RNA float in the cytoplasm, surrounded by cell membrane & wall DNA or RNA enclosed within a protein coat (capsid)
Living Attributes Living organism Non-living
Infection Localized Systemic
Enzymes Yes Yes, in some
Size > 1,000 nm < 400 nm
Beneficial Some (photosynthesis, vitamin production, nitrogen fixation) Not beneficial
How treated? Antibiotics Antivirals slow & vaccines prevent
# of cells Unicellular Non-living — no cells

Complete the Story

Activity Title: Complete the Story

Overview: This lesson extends the previous lesson on bacteria and viruses and carries us explicitly into the overall unit title: "Aliens Attack!" It sets the stage for the remaining lessons in that it has the students start to look at "What If..." scenarios. Students are challenged to put into words what they believe will happen (based on what they know of bacteria and viruses in the context of the particular circumstances). It is during this lesson that the engineering design process is re-introduced in order to prepare the students for using it in the last two lessons of the unit.

Learning Objectives: Summarize the role of bacteria and viruses in maintaining and disrupting the health of both organisms and ecosystems. Interpret the relationships (including predation, parasitism, commensalism, mutualism, and competition) among organisms. Recognize that the long-term survival of any species is dependent on changing resources that are limited.

Materials:

  • Internet-ready computer
  • Digital projector
  • Pen (or pencil)
  • "Engineering Design Process" Handout
  • Completed "Bacteria and Viruses Comparison Table"

Procedure:

EVALUATE

1. Show the students the first 35 seconds of the Andromeda Strain trailer: http://www.youtube.com/watch?v=edUWhyQHhc8 as a warm-up activity. Tell the students that they will be continuing with the material from the previous day’s lesson, but they will now use the engineering design process in order to determine possible outcomes to various scenarios.

Assessment: Students will work individually to speculate, in writing, as to the effects of introducing a foreign bacterium or virus into Earth’s various ecosystems.

Worksheets/Handouts:

  • “Complete the Story…” activity

Complete the Story...

Below you will find three images, each with a story starter. Using the picture as a reference, finish one of the stories to the best of your ability. Which story you write about will be determined by your last name: (A-J: scenario #1 / K-R: scenario #2 / S-Z: scenario #3). A minimum of three paragraphs is required (introduction, body, and conclusion) in order to get full credit.

Scenario #1

Despite warnings by NASA astrobiologists, anyone willing to pay the hefty fee for a ride to Mars was allowed to go. Upon landing, it was determined that the hygiene scrubbers were not used, and contaminating bacteria were introduced to the Martian ecology. At first, it was believed to be a non-issue, but recent telemetry readings show a decreased concentration of oxygen (O2) in the area, one that was unexpected considering the fact that humans use O2 and produce CO2, and would more likely contribute to an increase in carbon dioxide. These results can only be explained by...

Scenario #2

Missions to Mars have become so common that a tourist industry has developed over the years and people now travel to Mars as frequently as they travel to Hawaii. Recently, environmentalists have noticed a surge in red tide events in places where they normally do not occur — in fresh-water lakes and streams. Scientists have identified what appears to be a novel organism, but are having a difficult time classifying it. This organism is...

Scenario #3

During re-entry into Earth’s atmosphere, the spaceship Enterprise lost power and came in too steep, necessitating the successful ejection and recovery of the crew but the loss of the ship. The debris field of the destroyed ship spread across the Midwest. Initial analysis of the on-board science lab indicated that some samples may have been contaminated. It is believed that the recent complaint by consumers that their milk and cheese products taste funny could be linked somehow. You decide to investigate by...

Complete the Story... ANSWER KEY

Scenario #1

Despite warnings by NASA astrobiologists, anyone willing to pay the hefty fee for a ride to Mars was allowed to go. Upon landing, it was determined that the hygiene scrubbers were not used, and contaminating bacteria were introduced to the Martian ecology. At first, it was believed to be a non-issue, but recent telemetry readings show a decreased concentration of oxygen (O2) in the area, one that was unexpected considering the fact that humans use O2 and produce CO2, and would more likely contribute to an increase in carbon dioxide. These results can only be explained by... the introduction of bacteria from Earth onto Mars.

The normal bacteria found on the Martian surface are chemosynthetic, producing methane gas and water as a product of the reaction of carbon dioxide and hydrogen. They would thrive on the Martian surface were it not for the lack of excess hydrogen sitting around for their consumption. With this increase in oxygen, it is of the utmost importance that the source be discovered, as it could mean that there is a leak in one of the oxygen storage tanks or that another organism has begun taking over the ecology. In either case, the indigenous bacteria cannot thrive in oxygen-rich environments and could be wiped out.

Upon inspection of the O2 tanks, it was discovered that they were in fact not leaking and so the increased O2 had to be coming from elsewhere. In the process of checking the tanks however, one technician did note that he smelled pickles. While the initial thought was to ignore this as he believed his jumpsuit was just in need of a good cleaning, it was this observation that led NASA scientists to dig deeper at the site near the tanks. There they found that the soil beneath the encampment was unusually wet, and it was determined that a small leak in the sewage system had been identified as the cause. Because of this unique combination of circumstances, the scientists found two different bacterial colonies thriving just beneath the HVAC and water treatment facilities housed at the base of the encampment. One bacterial strain was identified as a lesser-known methanophile which was capable of taking methane and carbon dioxide and convert them into acetic acid (vinegar), hence the smell of pickles. The other was a photosynthetic bacterium that had managed to thrive, and was producing the localized increased in O2.

This discovery was very exciting, as it had never been considered to use multiple organisms with rather disparate life requirements as a means to synthesize a suitable environment for us to live in. Like many times before in science, it was serendipity that led to yet another important breakthrough.

NOTE The most important thing to remember when grading these is to understand that the point is to get the kids writing to construct meaning out of the numerous sources of information they have available to them while being creative in discerning possible explanations for the observed situation. The use of resources and creativity are key to the engineering design process.

Scenario #2

Missions to Mars have become so common that a tourist industry has developed over the years and people now travel to Mars as frequently as they travel to Hawaii. Recently, environmentalists have noticed a surge in red tide events in places where they normally do not occur — in fresh-water lakes and streams. Scientists have identified what appears to be a novel organism, but are having a difficult time classifying it. This organism is... a microscopic, unicellular organism with a reddish color. It lacks a nucleus and most organelles, contains RNA as its nuclear material, but does contain chloroplasts and mitochondria.

It is suspected that this microorganism was brought over on one of many Mars trips. Unfortunately, after inspecting each spaceship inside and out, all efforts to track its origin have failed. Further complicating the issue is the fact that what began as a small red coloration in isolated areas has spread rapidly. Because of the uniqueness of this microorganism and the potential for it to destroy indigenous life forms, it has become the focus of many research efforts.

Blooms of this type usually occur when a limited resource becomes overly abundant. What’s more, these blooms are considered harmful only when they reduce other normally abundant resources, such as when they die off and the decomposition of the organism leads to a depletion of oxygen. In this case, an analysis of water samples has shown that there doesn’t appear to be a higher concentration of the usual limiting agent, phosphorus. What’s more, there doesn’t appear to be an increase in the death of other organisms in the area nor a decrease in the overall oxygen concentration. In general, it appears to simply be a nuisance, as it has caused the normally blue-green waters to turn a reddish hue. In an effort to combat this, the areas containing these reddish bacteria were filtered to remove them and then set in isolated tanks where they are used as a chic, contemporary decoration in waterfalls in themed downtown hot spots.

NOTE The most important thing to remember when grading these is to understand that the point is to get the kids writing to construct meaning out of the numerous sources of information they have available to them while being creative in discerning possible explanations for the observed situation. The use of resources and creativity are key to the "engineering design process.

Scenario #3

During re-entry into Earth’s atmosphere, the spaceship Enterprise lost power and came in too steep, necessitating the successful ejection and recovery of the crew but the loss of the ship. The debris field of the destroyed ship spread across the Midwest. Initial analysis of the on-board science lab indicated that some samples may have been contaminated. It is believed that the recent complaint by consumers that their milk and cheese products taste funny could be linked somehow. You decide to investigate by... entering a cheese connoisseurs club in order to gain a knowledge of fine cheese products.

You begin your training in the art of making and critiquing fine cheeses by first learning about all the different types (Stilton, Gruyere, Swiss, etc.) as well as how they are made (types of fermenting media and conditions) and which foods pair best with them. From this you then move on to a study of different cheese flavors, trying hundreds of cheeses and making notes on the various nuances. When there seems to be no cheese you can’t identify by color, texture, flavor and scent, you approach the elders and request certification as a professional connoisseur of cheeses. After hours of grueling tests, you earn the rank as a Level I Connoisseur.

Certification in hand, you now tackle the task of testing cheese products in the affected area. You note the oddest things: cheddar that tastes like bleu cheese but without the typical blue-colored streaks, Swiss that has a slight alcohol flavor to it, and American that turns a greenish color as it ages. All these different cheese characteristics lead you to the unavoidable conclusion that the normal bacteria have either been replaced by some other contaminant or genetically modified. You, a geneticist, and a bacteriologist begin to study the cultures used in the cheese-making process and discover that there are in fact contaminating microorganisms in the batches. Unfortunately, studies of these bacteria alone do not explain the odd characteristics. It appears that what has occurred is that several genes have migrated from the contaminant to the normal bacteria. Until the full effects of these genetically altered bacteria can be ascertained, the cheese industry will now have to sterilize every piece of equipment, and start from scratch. What a sorrowful day it is when there is a future where the availability of cheese is in question!

NOTE The most important thing to remember when grading these is to understand that the point is to get the kids writing to construct meaning out of the numerous sources of information they have available to them while being creative in discerning possible explanations for the observed situation. The use of resources and creativity are key to the engineering design process.

Formative Assessment #2

  1. Bacteria play an important role in ecosystems as
    1. parasites.
    2. producers.
    3. decomposers.
    4. producers and decomposers.
  2. An acellular object that contains DNA or RNA and is protected by a protein coat is called a
    1. cell.
    2. virus.
    3. bacterium.
    4. protein.
  3. Important differences between archaebacteria and eubacteria include all of the following EXCEPT
    1. type of membrane lipids.
    2. presence of peptidoglycan.
    3. presence of capsid proteins.
    4. nucleotide sequences of DNA.
  4. The life cycle of a lytic virus does NOT involve
    1. infection.
    2. cell death.
    3. replication.
    4. lysogenic infection.
  5. Which gas in the atmosphere can some bacteria convert into biologically useful forms?
    1. oxygen
    2. hydrogen
    3. nitrogen
    4. water
  6. Which group includes some members that can carry out photosynthesis?
    1. both bacteria and viruses
    2. viruses but not bacteria
    3. bacteria but not viruses
    4. neither viruses nor bacteria
  7. In any lysogenic infection, the viral DNA
    1. is inserted into the host DNA.
    2. destroys the host DNA.
    3. replaces the host DNA.
    4. is destroyed by the host DNA.
  8. Bacteria that break down dead organic matter
    1. make nutrients available to other organisms.
    2. make nutrients unavailable to other organisms.
    3. survive and contribute to ecosystems as autotrophs.
    4. are mostly pathogens of humans and other animals.
  9. Bacteria cause disease by
    1. becoming part of a cell's DNA.
    2. releasing toxins or breaking down cells.
    3. decomposing dead organic matter.
    4. carrying viruses into healthy tissues.
  10. Bacteria can be identified by the following characteristics EXCEPT
    1. their shapes.
    2. the presence of a nucleus.
    3. how they move.
    4. the composition of their cell walls.

Formative Assessment #2: ANSWER KEY

  1. d. producers and decomposers.
  2. b. virus.
  3. c. presence of peptidoglycan.
  4. d. lysogenic infection.
  5. c. nitrogen
  6. c. bacteria but not viruses
  7. a. is inserted into the host DNA.
  8. a. make nutrients available to other organisms.
  9. b. releasing toxins or breaking down cells.
  10. b. the presence of a nucleus.

Genetics and Epidemiology

Activity Title: Genetics and Epidemiology

Overview: This is the final lesson in the unit, and is designed to be the culminating activity that gauges the students’ retention of all the content taught herein while concurrently gauging their understanding and application of the engineering design process.

Learning Objectives: Evaluate the significance of changes in DNA, specifically how natural selection produces change in populations. Evaluate models according to their limitations in representing biological objects or events.

Materials:

  • "Genetics and Epidemiology" Handout
  • Pen (or pencil)
  • Interactive notebook
  • Large Post-it® notes
  • Smart Board interactive whiteboard & Smart Notebook software
  • 12 Internet-ready computers (Mac or PC)
  • Netlogo applet software & "Genetics and Epidemiology Simulation" code

Procedure:

**Before the beginning of the lesson, the teacher will need to go to the Netlogo website: http://ccl.northwestern.edu/netlogo/ and download and install the software on all the computers the students will be using.**

ENGAGE

  1. Show the students the trailer for the movie "Children of Men" http://www.youtube.com/watch?v=NikEQy1XxDE and ask, "What do you think is the cause of infertility for all the women on Earth?" Guide a brief discussion over possible answers, but make sure that you refer back to the "Complete the Story" activity they just finished and that one of the answers includes the introduction of foreign DNA into the human genome from some infectious agent. Transition from here in the discussion to the next activity.

EXPLORE

  1. The teacher will facilitate a discussion over the vocabulary of instruction.
    1. Students will each write down 4-5 words/phrases in their interactive notebooks that they associate with the vocabulary term (right or wrong — whatever comes to mind).
    2. Students get into pairs or trios and compare answers, ultimately coming up with a list of 3 words/phrases they all agree are associated with the term.
    3. One representative from the group writes their 3 words/phrases on the Smart Board.
    4. Once all the groups have written their list, the teacher facilitates the process of having the students come up with a master class list of 3 words/phrases.
    5. The teacher then aids the students in deriving a definition of the term from the class list.
    6. Students must write down this collaboratively constructed definition on a large Post-it® note along with a mnemonic, picture, or clue, and then place each of theirs on the class word wall.

EXPLAIN

  1. Students will do the pre-reading and jigsaw activities on the content and one of the articles on lateral gene transfer.
    1. The teacher will guide the students through the process of numbering each paragraph to ensure continuity.
    2. Have the students get into their pre-assigned groups depending on the reading:
      1. Content handout: students in trios
      2. "Horizontal Gene Transfer Accelerating Evolution": students in pairs
      3. "Opportunity and Means: Horizontal Gene Transfer from the Human Host to a Bacterial Pathogen" article: students in groups of four
    3. For the jigsaw, the students are assigned a portion of the reading to complete.
      1. During the reading, the students are to highlight the vocabulary terms from the previous exercise and underline the main idea of each paragraph.
      2. Each student is responsible for explaining their section to the other members of the group. Once complete, each student will write a $3.00 summary (each word is worth $1.00, so the summary must be exactly 30 words).

ELABORATE

  1. The teacher will discuss the purpose of the activity by going through the background and set-up sections of the "Genetics and Epidemiology" Handout. Explain to the students that this activity will once again incorporate the use of modeling and simulations in order to emphasize the use of the engineering design process.
  2. Have the students complete the activity in pairs with the teacher facilitating their progress and aiding whenever the students become confused.

EVALUATE

  1. The students will complete the implementation plan graphic organizer, highlighting the design process and their solution.

Assessment: The students, as part of the attached activity, will complete an implementation plan which consists of a graphic organizer (flowchart) highlighting the design process steps and details about how they are going to correct the situation presented in the activity.

Worksheets/Handouts:

  • “Genetics and Epidemiology” Handout
  • Vocabulary list
  • “Lateral Gene Transfer” Handout (adapted from the Annenberg Learner website)
  • “Horizontal Gene Transfer Accelerating Evolution” article
  • “Opportunity and Means: Horizontal Gene Transfer from the Human Host to a Bacterial Pathogen” article

Genetics and Epidemiology

Background Information

Why do some people get sick, succumb to the illness, and die, while others never seem to even get a sniffle? For years, epidemiologists believed that the major factors affecting the spread of disease were a lack of clean water, poor hygiene, geographic climate, and the patterns of travel through any particular region. What is increasingly becoming apparent, however, is that genetics can also affect the degree to which a person is affected by an infectious agent. What’s more, scientists are discovering that not only can bacteria and viruses infect us and cause us to develop diseases; they can leave their own "genetic marks" in our genomes long after our immune systems have effectively fought them off.

So how did that foreign DNA get into our genomes? Genetic information is transferred in two major ways, called vertical gene transfer and horizontal gene transfer. Vertical gene transfer uses reproduction as a means of gene transfer through generations. This is how genes are passed from parents to offspring. Horizontal gene transfer, on the other hand, uses non-reproductive methods of gene transfer and is commonly seen among different strains of bacteria. Unfortunately, this type of transfer of genetic information has been shown to occur across species as well. In fact, it is believed that a good proportion of the "junk DNA" found in our genomes is there as a result of the horizontal transfer of genetic information from bacteria and viruses to humans. And it is believed that many of the autoimmune diseases and cancers that currently plague us could be the result of these pieces of "junk DNA," which were thought to be inactive, becoming activated!

Setup

For this exercise, you will be working in a group of three. You will take on the challenge of applying the engineering design process to the following problems, and develop solutions by looking at what would happen if these things occurred today:

  • What can we do to ensure that our presence on another planet doesn’t result in the devastation of native species?
  • What can we do to ensure that we do not bring back something that could:
    • cause a pandemic that devastates our species?
    • engrains some genetic information into our genomes that might affect later generations?

Procedure

1. To run the simulation, start the NetLogo application, click on "File," and scroll down to "Open." Navigate towards the "PopulationGrowth.nlogo" file and click on it. You will begin by using the Netlogo simulation on the computer stations to see just what might happen to our population should any of a variety of situations occur. In particular, you will look at three settings: 1) on the Martian surface; 2) in a highly-populated urban setting; and 3) in a sparsely populated rural setting.

2. In addition to looking at the setting, you will also be evaluating whether the population becomes exposed to 1) a benign organism; 2) a highly virulent, disease-causing organism; or 3) a seemingly benign organism that has the ability to horizontally transfer some of its genetic material into our genome.

3. The Table below gives the specific parameters that the simulator will need to be set to in order to get the results you are expected to use in evaluating your solutions.

Simulator Parameters
Initial Count (males) Initial Count (females) % A % U-C d-age A d-age U-C M-age (males) M-age (females) # Children (mean) # Children (sd)
Mars 100 100 2 98 10 5 2 2 10 5
City - 500 500 5 95 55 55 24 22 2 1
City - 500 500 5 95 30 55 24 22 2 1
City - 500 500 5 95 15 55 24 22 2 1
Rural - 50 50 5 95 65 65 19 18 4 2
Rural - 50 50 5 95 30 65 19 18 4 2
Rural - 50 50 5 95 15 65 19 18 4 2
Experiment A
Experiment B
Experiment C

4. Run each simulation 3 times and record your results in the "Data" section of the report. Each simulation should be run until the number of ticks recorded (i.e. the days that the simulation is running) either gets up to 36,500 (equal to 100 years or 5 generations) or the simulation stops because the population has gone to extinction.

5. Record the population of each subgroup in Data Table 1 when the simulation runs its course, and create a bar graph that plots that information.

6. Answer the questions that follow in the "Data" section as a means to begin the engineering process. Then use the simulator to test at least 3 corrective measures. Remember to input the values for each parameter for each measure.

7. Record the population of each subgroup in Data Table 2 when the simulation runs its course, and create a bar graph that plots that information.

8. Answer the questions that follow in the "Data" section as a means to draw some conclusions as to which corrective measure you would implement.

Data

Data Table 1
Population "A" males Population "U" males Population "C" males Population "A" females Population "U" females Population "C" females
Mars 1
Mars 2
Mars 3
City 1 -
City 2 -
City 3 -
City 1 -
City 2 -
City 3 -
City 1 -
City 2 -
City 3 -
Rural 1 -
Rural 2 -
Rural 3 -
Rural 1 -
Rural 2 -
Rural 3 -
Rural 1 -
Rural 2 -
Rural 3 -

1. Which was the largest group at the beginning of the simulation? At the end?

\\\\\\

2. Which group(s) went to extinction?

\\\\\\

3. Were the largest groups still the largest at the end of the simulation?

\\\\\\

4. What types of things can we do to reverse or prevent these results from happening?

\\\\\\

Data Table 2
Population "A" males Population "U" males Population "C" males Population "A" females Population "U" females Population "C" females
Experiment A1
Experiment A2
Experiment A3
Experiment B1
Experiment B2
Experiment B3
Experiment C1
Experiment C2
Experiment C3

1. Which experiment was the most successful at reversing and/or preventing the situations that were seen in the original simulations?

\\\\\\

2. If more than one was effective, how would you determine which one was the best?

\\\\\\

3. What types of things did you consider when determining which experiment was the best?

\\\\\\

Implementation Plan

Create a graphic representation of how you would implement your corrective measure.

Vocabulary List

"Lateral Gene Transfer"

Lateral (horizontal) gene transfer
Transformation
Transduction
Conjugation
Competent
Endonuclease
Homologous recombination
Bacteriophage
Gene
Virulence
Lysogeny
Prophage
F-pilus
Plasmid
Antibiotic resistance gene

"Horizontal Gene Transfer Accelerating Evolution"

Horizontal gene transfer
Transposable
Drug-resistant bacteria
Sexual selection
Sexual recombination
Point mutation
Adaptive immune system

"Opportunity and Means: Horizontal Gene Transfer from..."

Horizontal gene transfer
Phylogenetic
Reverse transcription
Coevolution
Gonococcal
Biosynthetic
Virulence
Antibiotic resistance
Competent
Transformation
Exogenous
Microevolution
Endonuclease
Reverse transcriptase
Retrotransposition

Lateral Gene Transfer

Bacteria possess several methods for lateral gene transfer (also called horizontal gene transfer), the transmission of genes between individual cells. These mechanisms not only generate new gene assortments, they also help move genes throughout populations and from species to species. The methods include transformation, transduction, and conjugation.

Transformation

Transformation involves the uptake of "naked" DNA (DNA not incorporated into structures such as chromosomes) by competent bacterial cells (Figure above). Cells are only competent, or capable of taking up DNA, at a certain stage of their life cycle, apparently prior to the completion of cell wall synthesis. Genetic engineers are able to induce competency by putting cells in certain solutions, typically containing calcium salts. At the entry site, endonucleases cut the DNA into fragments of 7,000-10,000 nucleotides, and the double-stranded DNA separates into single strands. The single-stranded DNA may recombine with the host's chromosome once inside the cell. This recombination replaces the gene in the host with a variant (albeit homologous) gene. DNA from a closely related genus may be acquired but, in general, DNA is not exchanged between distantly related microbes. Not all bacteria can become competent. While transformation occurs in nature, the extent to which it contributes to genetic diversity is not known.

Transformation

Transduction is another method for transferring genes from one bacterium to another. This time, the transfer is mediated by bacteriophages — bacterial viruses, also called phages (Figure above). A bacteriophage infection starts when the virus injects its DNA into a bacterial cell. The bacteriophage DNA may then direct the synthesis of new viral components assembled in the bacterium. Bacteriophage DNA is replicated and then packaged within the phage particles. Early in the infective cycle the phage encodes an enzyme that degrades the DNA of the host cell. Some of these fragments of bacterial DNA are packaged within the bacteriophage particles, taking the place of phage DNA. The phage can then break open, or lyse, the cell. When released from the infected cell, a phage that contains bacterial genes can continue to infect a new bacterial cell, transferring the bacterial genes. Sometimes genes transferred in this manner become integrated into the genome of their new bacterial host by homologous recombination. Such transduced bacteria are not lysed because they do not contain adequate phage DNA for viral synthesis. Transduction occurs in a wide variety of bacteria and is a common mechanism of gene transfer.

Some bacteriophages contribute to the virulence of bacterial infections. Certain phages can enter an alternate life cycle called lysogeny. In this cycle, all the virus's DNA becomes integrated into the genome of the host bacterium. The integrated phage, called a prophage, can confer new properties to the bacterium. For example, strains of Corynebacterium diptheriae, which have undergone lysogenic conversion, synthesize the toxin in diphtheria that damages human cells. Clostridium botulinum and Streptococcus pyogenes, when lysogenized by certain phages, also manufacture toxins responsible for illness, causing botulism and scarlet fever, respectively. Strains lacking the prophage do not produce the damaging toxins.

Conjugation

Conjugation is another means of gene transfer in many species of bacteria (Figure above). Cell-to-cell contact by a specialized appendage, known as the F-pilus or sex pilus, allows a copy of an F-(fertility) plasmid to transfer to a cell that does not contain the plasmid. On rare occasions, an F-plasmid may become integrated in the chromosome of its bacterial host, generating what is known as an Hfr (high frequency of recombination) cell. Such a cell can also direct the synthesis of a sex pilus. As the chromosome of the Hfr cell replicates, it may begin to cross the pilus so that plasmid and chromosomal DNA transfers to the recipient cell. Such DNA may recombine with that of its new host, introducing new gene variants. Plasmids encoding antibiotic-resistance genes are passed throughout populations of bacteria, and between multiple species of bacteria, by conjugation.

Lateral gene transfer is a potent evolutionary force that can create diversity within bacterial species. As genes for virulence factors and antibiotic resistance spread between and among bacterial populations, scientists are realizing how integral these mechanisms are to the emergence of novel pathogens.

Downloaded from the Annenberg Learner website: http://www.learner.org/courses/biology/textbook/infect/infect_7.html

30 January 2007

Horizontal Gene Transfer Accelerating Evolution

by Kate Melville

Fossil records indicate that single-celled life first appeared about 3.5 billion years ago. It then took about 2.5 billion more years for multicellular life to evolve. Then, in the space of only a billion years, plants, mammals, insects, birds, and other species exploded across the Earth. Now, scientists from Rice University think they may be closer to understanding why the speed and complexity of evolution appears to increase with time.

The Rice researchers suggest that the speed of evolution has increased over time thanks to horizontal gene transfer, where bacteria and viruses exchange transposable chunks of DNA between species, thus making it possible for life forms to evolve faster than they would if they relied only on sexual selection or random genetic mutations.

Horizontal gene transfer (HGT) is a cross-species form of genetic transfer. It occurs when the DNA from one species is introduced into another. The idea was pooh-poohed when first proposed more than 50 years ago, but the advent of drug-resistant bacteria and other discoveries, including the identification of a specialized protein that bacteria use to swap genes, has recently led to wide acceptance of the theory.

In the past, mathematical models of evolution have focused largely on how populations respond to single mutations, the random changes in single nucleotides on the DNA chain. Other theories have focused on recombination, the process that occurs in sexual selection when the genetic sequences of parents are recombined.

The new mathematical model, developed by Rice’s Michael Deem and visiting professor Jeong-Man Park, attempts to find out how HGT changes the overall dynamics of evolution. In comparison to existing models that account for only point mutations or sexual recombination, Deem and Park’s model shows how HGT increases the rate of evolution by propagating favorable mutations across populations.

Published in Physical Review Letters, the new model shows how HGT compliments the modular nature of genetic information, making it feasible to swap whole sets of genetic code - like the genes that allow bacteria to defeat antibiotics. "We have developed the first exact solution of a mathematical model of evolution that accounts for this cross-species genetic exchange," said Deem. "We know that the majority of the DNA in the genomes of some animal and plant species — including humans, mice, wheat and corn — came from HGT insertions. For example, we can trace the development of the adaptive immune system in humans and other jointed vertebrates to an HGT insertion about 400 million years ago. Life clearly evolved to store genetic information in a modular form, and to accept useful modules of genetic information from other species."

Downloaded from the Science AGOGO website: http://www.scienceagogo.com/news/20070029220033data_trunc_sys.shtml

Opportunity and Means: Horizontal Gene Transfer from the Human Host to a Bacterial Pathogen

Mark T. Anderson and H. Steven Seifert

Department of Microbiology-Immunology, Northwestern University, Feinberg School of Medicine, Chicago, Illinois, USA

ABSTRACT The acquisition and incorporation of genetic material between nonmating species, or horizontal gene transfer (HGT), has been frequently described for phylogenetically related organisms, but far less evidence exists for HGT between highly divergent organisms. Here we report the identification and characterization of a horizontally transferred fragment of the human long interspersed nuclear element L1 to the genome of the strictly human pathogen Neisseria gonorrhoeae. A 685-bp sequence exhibiting 98 to 100% identity to copies of the human L1 element was identified adjacent to the irg4 gene in some N. gonorrhoeae genomes. The L1 fragment was observed in ~11% of the N. gonorrhoeae population sampled but was not detected in Neisseria meningitidis or commensal Neisseria isolates. In addition, N. gonorrhoeae transcripts containing the L1 sequence were detected by reverse transcription-PCR, indicating that an L1-derived gene product may be produced. The high degree of identity between human and gonococcal L1 sequences, together with the absence of L1 sequences from related Neisseria species, indicates that this HGT event occurred relatively recently in evolutionary history. The identification of L1 sequences in N. gonorrhoeae demonstrates that HGT can occur between a mammalian host and a resident bacterium, which has important implications for the co-evolution of both humans and their associated microorganisms.

IMPORTANCE The interactions between microbes and their hosts are relevant to several aspects of biology, including evolution, development, immunity, and disease. Neisseria gonorrhoeae serves as a particularly informative model for this interaction because it has exclusively coevolved with humans and is not known to be found in any other environment. In addition, investigation of the evolutionary relationship between N. gonorrhoeae and humans has practical implications, since gonorrhoea is a prevalent sexually transmitted infection worldwide. This study was undertaken to characterize the horizontal transfer of genetic information from humans to N. gonorrhoeae, an event that has been scarcely recognized between any mammalian host and bacterial pathogen. Here we provide evidence that this genetic exchange was the result of a recent evolutionary event that has been propagated within the gonococcal population.

Received 6 January 2011 Accepted 12 January 2011 Published 15 February 2011

Citation Anderson, M.T., and H.S. Seifert. 2011 Opportunity and means: horizontal gene transfer from the human host to a bacterial pathogen. mBio 2(1):e00005-11. doi: 10.1128/mBio.00005-11.

Editor Stanley Maloy, San Diego State University

Copyright © 2011 Anderson and Seifert. This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported License, which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original author and source are credited.

Address correspondence to H. Steven Seifert, h-seifert@northwestern.edu.

Evolution of asexual organisms can occur by the accumulation and vertical transmission of mutations in an existing genetic repertoire or through the acquisition of novel genetic determinants by horizontal gene transfer (HGT). HGT has the capacity to facilitate the acquisition of complex physiological functions (1) in a single molecular event and has been estimated to account for up to 17% of the total genetic material found in Escherichia coli (2). HGT must therefore be regarded as an important force in the adaptation of species. HGT is particularly well known to have a diverse impact on bacterial physiology, with examples in the literature describing the horizontal acquisition of novel biosynthetic (3), virulence (1), and antibiotic resistance (4) functions by diverse bacterial species. Despite the countless interactions between commensal or pathogenic bacteria and their cognate hosts and the ever-increasing amount of available genomic sequence data, examples of bacterial integration of host genetic information are exceedingly rare. The rarity of HGT from host to bacterium may be due, in part, to potential barriers such as restriction and modification functions, the availability of genetic material, and the fitness cost of deleterious HGT events. However, such an event has the potential to impact the evolution of both the host and the microbe.

Neisseria gonorrhoeae is the causative agent of the sexually transmitted infection gonorrhea. N. gonorrhoeae is naturally competent for transformation and has incorporated DNA from related neisserial species (5, 6) and more divergent bacterial species (7) into its genome. Recombination of exogenous DNA occurs efficiently in N. gonorrhoeae, and it is postulated that this process plays an important role in the microevolution of the organism (8, 9). N. gonorrhoeae has a long and exclusive evolutionary history with its human host, and infection is typically localized to the urogenital tract. Therefore, sources of foreign DNA available to the gonococcus are limited to coinhabiting microorganisms or the host itself. Mammalian genomes contain numerous copies of the long interspersed nuclear element (LINE) L1. Full-length human L1 elements encode a nucleic acid binding protein and a multidomain protein with endonuclease and reverse transcriptase activities (10), which together facilitate mobilization of the element via retrotransposition (11). This work establishes the presence of N. gonorrhoeae genome sequences with strong identity to human LINE L1 (10) and characterizes the results of this HGT event.

Map of the nL1 fragment in N. gonorrhoeae. (A) Schematic of a full-length L1 element. (B) The 10 terminal nucleotides of the 685-bp nL1 insertion are shown in their corresponding locations on the L1 element (GenBank accession no. U09116.1). (C) The nL1 insertion site within the N. gonorrhoeae genome is denoted by the bold arrow and is 14 bp upstream of the irg4 start codon. The specific irg allele was identified using the nomenclature established for the FA1090 annotation (16). The first 6 amino acids of Irg4 are shown. Two 24-bp inverted repeats in the genococcal genome are underlined, and the highlighted sequence designates one terminus of the Nf4-G4 prophage sequence that includes the irg4 ORF (15). UTR, untranslated region.

RESULTS

The genome sequences of 14 N. gonorrhoeae clinical isolates were recently determined and made publicly available by the Neisseria gonorrhoeae group Sequencing Project (http://www.broadinstitute.org/), adding to the existing genome sequences of FA1090 and NCCP11945 (12). Analysis of the unfinished assemblies identified a 685-bp fragment present in strains FA6140 (supercontig 29, positions 23818 to 24502), DGI18 (supercontig 24, positions 24037 to 24721), and PID24 (supercontig 27, positions 23854 to 24538) that exhibited 98 to 100% identity to copies of human retrotransposable element L1. This Neisseria L1 sequence (nL1) also exhibits strong similarity to LINEs from other primates (e.g, Pan troglodytes), but since humans are the only known natural host for N. gonorrhoeae, it is likely that the HGT event that yielded nL1 occurred in humans. The nL1 fragment is identical among the FA6140, DGI18, and PID24 Neisseria strains and occupies the same insertion site (Figure above). The nL1 element includes the coding sequence for the first 164 amino acids of the L1 open reading frame 1 (ORF1) nucleic acid binding protein (13) and 192 bases of the L1 5’ untranslated region upstream of ORF1. This region of the ORF1 protein contains a coiled-coil domain that is required for trimerization of the murine ORF1 protein and the first 8 amino acids of a 96-residue RNA recognition motif (14). The insertion site in the gonococcal genome is located 14 bp upstream of a copy of the phage-associated transposase irg4 (15, 16). This genetic region also contains a 24-bp inverted repeat, one of which is interrupted by the nL1 insertion (Figure above). Although repeat sequences and mobile genetic elements are often associated with HGT, comparison of nL1-positive and nL1-negative genomes yields no evidence that either the putative Nf4-G4 prophage or the inverted repeat was directly involved in the acquisition of nL1.

Contamination of DNA sequencing samples has previously accounted for the false identification of LINE sequences in human-associated microorganisms (17). To test whether the presence of nL1 was the result of contamination introduced during the sequencing or purification of gonococcal DNA, independently prepared genomic DNA from the sequenced N. gonorrhoeae isolates was assayed for the presence of nL1 by PCR. Multiple reactions containing primer combinations specific to the nL1 sequence and flanking DNA verified the presence of nL1 in the genomic location predicted by the sequences (Figure below). Sequencing of nL1 containing PCR products confirmed this result and the composition of nL1 as reported in the genome sequences of all three strains (data not shown). DNA hybridizations using a probe generated from human L1 sequences also confirmed that strains FA6140, DGI18, and PID24 contained nL1 and that this fragment was not located at an alternative site in the genomes of the remaining 12 strains from Figure below (data not shown). Together, these analyses conclusively demonstrate that the presence of L1 DNA in strains PID24, DGI18, and FA6140 is attributable to HGT and is not an artifact of genome sequencing.

To assess the frequency of nL1 in the population, a diverse collection of Neisseria strains, isolated at different times and locations, were screened for the presence of nL1 using a combination of molecular and bioinformatic techniques (see Table S1 in the supplemental material). Four additional nL1-positive N. gonorrhoeae strains were identified by this analysis (97G181, ATCC49226, PID334, and WHO I) and determined to harbor a 685-bp sequence identical to that reported for the sequenced nL1-positive strains. Therefore, the nL1 allele occurred at a frequency of \sim 11\% among the 62 N. gonorrhoeae strains that were included in this study. Interestingly, the different disease manifestations of N. gonorrhoeae infection (uncomplicated infection, pelvic inflammatory disease, disseminated gonococcal infection) were all represented among the nL1-positive strains identified here. Although closely related members of the genus Neisseria are also exclusively associated with human infection, examination of 212 Neisseria meningitidis isolates and 19 commensal Neisseria isolates produced no evidence of the nL1 fragment (see Table S1 in the supplemental material). Assuming that the frequency of occurrence is similar in N. meningitidis and N. gonorrhoeae, the probability of observing zero nL1 events in the N. meningitidis population tested is 1.9E^{-11}, since the number should follow a binomial distribution with n=212 and P=0.11. The lack of nL1 sequences in the highly genetically related species N. meningitidis suggests that the acquisition of nL1 by N. gonorrhoeae was a recent evolutionary event that occurred subsequent to the divergence of N. meningitidis and N. gonorrhoeae. The identification of nL1 in gonococci but not meningococci may reflect differences in the species-specific interactions between bacteria and host cells, the availability of host DNA during infection with N. gonorrhoeae versus N. meningitidis, or most likely an event that occurred after the two species diverged.

PCR amplification of the nL1 fragment in N. gonorrhoeae isolates and nL1 transcript detection by RT-PCR. Purified genomic DNA from sequenced gonococcal isolates and human chromosomal DNA were used as templates for PCR amplification of the nL1 fragment and L1. (A) Primers IS1106 for and IRGrev anneal to sequences flanking the nL1 insertion site and yield products of 1,090 and 405 bp for nL1-positive and nL1-negative alleles, respectively. Neither product was detected in DNA from strain SK-93-1035, but this isolate is not predicted to harbor the nL1 fragment. (B) Reactions using primers LINEfor and LINErev, which anneal to sequences internal to the human L1 element and the nL1 fragment. Combinations of flanking and internal primers LINErev and IS1106 for (C) or LINEfor and IRGrev (D) were used to confirm the genomic location of nL1. The background bands visible in panels A and C are not due to nL1 sequence amplification, since all of the strains shown here, except PID24, DGI18, and FA6140, were also determined to be nL1 negative by DNA hybridization. Total RNA from nL1-containing isolates (DGI18, PID24, PID334, and FA6140) was used as the template in RT reaction mixtures containing (+RT) or lacking (-RT) reverse transcriptase. The resulting cDNA was amplified with internal nL1 primers L1for and L1rev. Isolates FA1090, MS11, and NCPP11945 lack the L1 fragment and were included as negative controls. Purified genomic DNA from isolate PID334 was used as a positive control. Products were obtained with cDNA generated from positive-strand (E) and negative-strand (F) RNA transcripts.

The absolute conservation of the nL1 sequence among the seven positive isolates is striking and suggests that this locus is under selective pressure or has not had sufficient time to degenerate. Reverse transcription (RT)-PCR using total RNA and internal L1 primers detected transcripts containing the nL1 sequence originating from both stands of DNA (Figure above). Therefore, the HGT event that yielded nL1 has the potential to produce a novel gene product and may contribute to the observed sequence conservation. However, because the frequency of nL1 occurrence in the tested population is modes, any selective force conferred by nL1 may be small and difficult to identify experimentally. During laboratory culture, no consistent gross phenotypic differences between nL1-positive and nL1-negative strains were observed.

In addition to selective pressure, clonal expansion could also account for the observed lack of variation of the nL1 allele among N. gonorrhoeae isolates. Multilocus sequencing typing (MLST) (18) was used to assess the relatedness of four nL1-positive isolates compared to 12 confirmed L1-negative isolates for which allele sequences were available. Strains DGI18 and PID24 have identical MLST profiles belonging to sequence type 8418 and may represent clonal expansion of the nL1 allele (Table 1). However, strains FA6140 and PID334 have sequence types divergent from both sequence type 8418 and each other. Since three distinct sequence types are represented among the four nL1 strains analyzed, either the presence of the nL1 fragment in these strains was the result of multiple identical HGT events or, more likely, an initial acquisition of nL1 from humans was subsequently transferred horizontally between gonococcal strains.

MLST profiles of the N. gonorrhoeae strains used in this study
Strain abcZ adk aroE fumC gdh pdhC pgm Sequence type
NCCP11945 109 39 170 111 148 153 65 1901
FA19 59 39 67 156 188 71 133 1892
MS11 126 39 67 78 146 153 133 6959
1291 126 39 170 158 149 531 65 8422
35/02 59 39 67 78 148 153 65 7363
FA6140 126 39 67 78 149 71 65 1927
PID1 126 39 67 156 149 71 133 8417
PID18 59 113 67 158 148 154 133 1926
PID24 109 39 170 78 228 71 65 8418
PID332 109 39 67 156 152 71 65 1594
PID334 126 39 67 156 146 71 65 8423
FA1090 109 39 67 190 147 71 65 1899
SK-92-679 59 39 67 111 149 153 65 6715
SK-93-1035 129 39 67 156 149 153 65 1595
DGI2 59 113 67 158 147 530 133 8421
DGI18 109 39 170 78 228 71 65 8418

DISCUSSION

The high level of identity between human L1 and nL1 sequences, combined with its absence in closely related Neisseria species, suggests that this HGT event happened relatively recently in evolutionary history and/or that the nL1 region is under strong selective pressure. In addition, the low penetrance of nL1 within the gonococcal population is consistent with the hypothesis that nL1 was acquired recently from humans. Since numerous different L1 copies exist in any one human genome, including ones that contain sequences identical to nL1 (GenBank accession no. AC013546), analysis based on the accumulation of synonymous and nonsynonymous subsititutions relative to a donor sequence is not feasible. N. gonorrhoeae can be found intracellularly and extracellularly associated with neutrophils and epithelial cells and thus has the opportunity to encounter host DNA during infection (19, 20). The natural competence of N. gonorrhoeae provides the bacterium with the means to acquire exogenous DNA, and the fact that the signature Neisseria DNA uptake sequence is not absolutely required for internalization of exogenous DNA (21) increases the probability of this event’s occurrence. Although N. gonorrhoeae can invade and replicate within host cells, there is no evidence for nuclear association, making interaction with host DNA in live cells unlikely. A potential scenario in which HGT between humans and intracellular N. gonorrhoeae could more readily occur is after an apoptotic (22) or necrotic event in which the host DNA is fragmented or disrupted within the dying cell. Alternatively, the active secretion of neutrophil extracellular traps (23) provides a means by which host DNA could become accessible to extracellular N. gonorrhoeae.

The mechanism by which this foreign genetic material was incorporated into the N. gonorrhoeae genome is a matter of speculation. Comparison of the insertion site between nL1-positive and nL1-negativve isolates demonstrates that the recombined fragment is the result of a simple insertion with no loss or gain of flanking chromosomal information (Figure above). Mobilization of L1 elements within the nuclei of host cells occurs via target-primed RT (11), which requires the function of ORF1p and ORF2p and results in target site duplication. No such signature duplication is present near the nL1 site, and retrotransposition is unlikely to account for the insertion of nL1 into the N. gonorrhoeae genome. There is no homology between the gonococcal insertion site and the L1 sequences flanking the nL1 fragment, suggesting that direct recombination after transformation is also an unlikely mechanism for the integration of nL1. Therefore, we postulate that non-homologous end joining (NHEJ) could have occurred between a fragmented copy of L1 and the recipient region of the N. gonorrhoeae genome. Although N. gonorrhoeae lacks the NHEJ machinery possessed by some bacteria, alternative pathways of low-frequency NHEJ that have potential to mediate HGT of exogenous sequences have been proposed (24).

Regardless of the mechanism by which HGT occurred, it is possible that nL1 has an effect on the physiology of N. gonorrhoeae by way of residual activity of the truncated ORF1 protein (if produced) or via polar effects of the insertion itself. More significantly, though, the identification of human sequences within the N. gonorrhoeae genome has important implications for modelling of the generation of genetic diversity and evolution of this and other obligate human pathogens and establishes that HGT can occur between a mammalian host and an associated microorganism.

MATERIALS AND METHODS

Bacterial strains and culture conditions. The Neisseria isolates used in this study and their sources are listed in Table S1 in the supplemental material. N. gonorrhoeae and commensal Neisseraia species were grown on gonococcal medium base (Difco) containing Kellogg supplements as described previously (25). N. meningitidis strains were cultivated on gonococcal medium supplemented with 1% IsoVitaleX (Becton Dickinson). Bacteria used for the preparation of RNA were grown to exponential phase as described previously (25) in GCBL broth (1.5% proteose peptone no. 3 [Difco], 0.4% K_2HPO_4, 0.1% KH_2PO_4, 0.1% NaCL) supplemented with 1% IsoVitaleX.

Detection of the nL1 allele. All of the oligonucleotide primers used in this study are listed in Table S2 in the supplemental material. Genomic DNA was purified on QIAamp columns (Qiagen) and used for PCR and slot blot hybridizations. The nL1 genotype of the N. gonorrhoeae strains listed in Figure above was established using the following primer combinations: IS1106 for and IRGrev, LINEfor and LINErev, IS1106for and LINErev, and LINEfor and IRGrev. All other Neisseria isolates screened by PCR as reported in Table S1 in the supplemental material were screened by the LINEfor and LINErev primer pair at minimum. PCR products were sequenced by the Northwestern University Genomics Core Facility. A sampling of isolates of each Neisseria species screened was analysed slot blot hybridization using a 541-bp probe PCR amplified from human chromosomal DNA using primers LINEfor and LINErev. The product was labelled with digoxigenin-dUTP via the random-primed method (Roche), and hybridizations were performed using standard techniques. The binomial distribution was used to determine the probability of observing zero nL1 events in N. meningitidis based on the N. gonorrhoeae frequency and assuming equivalent rates. The Northwestern University Biostatistics Collaboration Center assisted with the statistical analysis.

RT-PCR. Total RNA was purified from N. gonorrhoeae cultures using the RNeasy kit (Qiagen) and treated with RQ1 DNase (Promega) to remove genomic contamination. The LINEfor and LINErev oligonucleotides were used to prime cDNA synthesis using Superscript III reverse transcriptase (Invitrogen) according to the manufacturer’s recommendations. Internal nL1 primers L1 for and L1rev were used to PCR amplify cDNA products.

MLST. Seven housekeeping genes; abcz, adk, aroE, fumC, gdh, pdhC, and pgm, were used to establish the sequence types of N. gonorrhoeae strains as described previously (18), with the exception of the oligonucleotide primers that were used for amplification and sequencing of MSLT alleles. Allele numbers were assigned by querying the Neisseria MLST database (18) using existing genomic sequence when available. The MLST primers listed in Table S2 in the supplemental material were used to PCR amplify and sequence (both strands) all alleles from strain PID334 and any other allele not previously established in the database. The profiles of all of the strains listed in Table 1 have been deposited in the Neisseria MLST database.

ACKNOWLEDGMENTS

We acknowledge M. Apicella, J. Dillard, K. Lee, R. Nicholas, P. Rice, W. Shafer, D. Trees, and W. Whittington for contributing Neisseria strains; J. Bodily for providing preparations of human genomic DNA; K. Clark for performing the bioinformatics screen that identified the nL1 sequences; D. Ward and M. Giovanni for facilitating the genomic sequencing of N. gonorrhoeae strains; M. Fitzgerald for providing genomic assemblies; M. Maiden for providing access to N. meningitidis genome sequences; K.-Y. Kim for assisting with the statistical analysis; and A. Chen and A. Hauser for critical reading of the manuscript.

This work was supported by NIH grants R01 AI044239 and R37AI033493 to H.S.S. M.T.A. was partially supported by NIH fellowship F32AI080083.

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at http://mbio.asm.org/lookup/suppl/doi:10.1128/mBio.00005-11/-/DCSupplemental.

Table S1, PDF file, 0.189 MB.

Table S2, PDF file, 0.042 MB.

REFERENCES

  1. McDaniel, T. K., and J. B. Kaper. 1997. A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E. coli K-12. Mol. Microbiol. 23: 399-407.
  2. Lawrence, J. G., and H. Ochman. 1997. Amelioration of bacterial genomes: rates of change and exchange. J. Mol. Evol. 44: 383-397.
  3. Goldman, B. S., and R. G. Kranz. 1998. Evolution and horizontal transfer of an entire biosynthetic pathway for cytochrome c biogenesis: Helicobacter, Deinococcus, Archae and more. Mol. Microbiol. 27: 871-873.
  4. Davies, J., and D. Davies. 2010. Origins and evolution of antibiotic resistance. Microbiol. Mol. Biol. Rev. 74:417-433.
  5. Feil, E., J. Zhou, J. Maynard Smith, and B. G. Spratt. 1996. A comparison of the nucleotide sequences of the adk and recA genes of pathogenic and commensal Neisseria species: evidence for extensive interspecies recombination within adk. J. Mol. Evol. 43: 631-640.
  6. Spratt, B. G., L. D. Bowler, Q. Y. Zhang, J. Zhou, and J. M. Smith. 1992. Role of interspecies transfer of chromosomal genes in the evolution of penicillin resistance in pathogenic and commensal Neisseria species. J. Mol. Evol. 34:115-125.
  7. Kroll, J. S., K. E. Wilks, J. L. Farrant, and P. R. Langford. 1998. Natural genetic exchange between Haemophilus and Neisseria: intergeneric transfer of chromosomal genes between major human pathogens. Proc. Natl. Acad. Sci. U. S. A. 95: 12381-12385.
  8. Fudyk, T. C., I. W. Maclean, J. N. Simonsen, E. N. Njagi, J. Kimani,

Downloaded from the American Society of Microbiology website: http://mbio.asm.org/content/2/1/e00005-11

Image Attributions

Description

Subjects:

Grades:

Date Created:

Jul 27, 2012

Last Modified:

Apr 29, 2014
Files can only be attached to the latest version of None

Reviews

Please wait...
Please wait...
Image Detail
Sizes: Medium | Original
 

Original text